Description
Background:
- coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced (1).
Specifications:
Product: Recombinant full-size LexA protein without tag.
Form: 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT
Purity: Over 90% by SDS-PAGE (CBB staining)
Protein concentration: 1.0 mg/ml as measured by BCA method
Storage: Shipped at 4℃ or -20℃ and stored at -20℃ or -80℃ for longer period.
Applications
- Functional studies on the mechanism of coli SOS response. This product binds to SOS box in vitro and repress the expression of the genes belonging to SOS regulon.
- Western Blotting. Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the yeast two-hybrid method using the lexA
gene. See also antibody to LexA protein (#61-001)
- Chromatin immuno-precipitation in combination with
anti-LexA antibody (#61-001)
Data Link UniProtKB/Swiss-Prot P0A7C2 (LEXA_ECOL)
Figure. SDS-PAGE analysis of the purified LexA protein. |
References:
- Waker GC “Understanding the complexity of an organism’s responses to DNA damage.” 2000) PMID: 12760015
Sambrook J & Russell DW Molecular Cloning 3rd Ed. Chapter 18. 17-18.27 Cold Spring Harber Laboratory Press (2001)
Reviews
There are no reviews yet.